Basic Info
Starting a new search ...
Basic Information for the CNV-ceRNA event
10q24.31
OLMALINC ( ENSG00000235823)
hsa-miR-199a-3p (MIMAT0000232)
DNAJA4 (ENSG00000140403)
UCEC
1.55E-3
 Circulating |
 Drug resistent |
 Survival |
Binding Info
miRNA Binding site information on lncRNA
miRanda target site prediction
|
|
TargetScan target site prediction
miRNA 3' AUUGGUUACACGUCUGAUGACA 5' hsa-miR-199a-3p | Start: 2487 End: 2494Site type: 8mer-1a Context++ Score: -0.424 |
miRNA 3' AUUGGUUACACGUCUGAUGACA 5' hsa-miR-199a-3p | Start: 2487 End: 2494Site type: 8mer-1a Context++ Score: -0.424 |
RNAbybrid target site prediction
|
|
Functions
Dysregulated fucntions of CNV-ceRNA event
Hallmarks
Dysregulated hallmarks of CNV-ceRNA event
Network
Related ceRNA network disturbed by CNV
Survival
Survival status of ceRNA interaction
Samples
Samples with different CNV status
Annotations
External Annotation for OLMALINC
LncRNA-associated competing triplets and functions.
Comprehensive experimentally supported associations between lncRNA and human cancer.
An open-source platform for studying the RNA-RNA interactions from CLIP-seq data.
An integrated knowledge database dedicated to non-coding RNAs.
An integrated database of human annotated lncRNA transcripts.
Comprehensive annotations of eukaryotic long non-coding RNAs.
External Annotation for hsa-miR-199a-3p
A high quality database of published miRNA sequences and annotation.
A curated miRNA-target database developed by DIANA LAB.
A miRNA-target database by manually filter research articles related to functional studies of miRNAs.
A comprehensive of microRNA diversity, expression profiles, target relationships, and various supporting tools.
External Annotation for DNAJA4
Information on all annotated and predicted human genes.
Gene nomenclature, gene families and associated resources (genomic, proteomic, phenotypic information).
Genome browser for vertebrate genomes.
An annotated collection of all publicly available DNA sequences.
External Annotation for variation: 10q24.31
A comprehensive, authoritative compendium of human genes and genetic phenotypes.
A database of human single nucleotide variations, microsatellites, and small-scale insertions and deletions
The catalogue of somatic mutations in cancer.