Basic Info
Starting a new search ...
Basic Information for the SNP-ceRNA event
rs5873734 chr6:205918(A/AT)
AL035696.1 ( ENSG00000205653)
hsa-miR-24-2-5p (MIMAT0004497)
BCL2 (ENSG00000171791)
EUR_YRI
3.55E-2
 Circulating |
 Drug resistent |
 Survival |
Binding Info
Altered binding affnity between reference and alternative allele
miRanda reference allele (loss)
|
|
miRanda alternative allele (loss)
|
|
TargetScan reference allele (gain)
miRNA 3' GACACAAAGUCGAGUCAUCCGU 5' hsa-miR-24-2-5p | Start: 37 End: 44Site type: 8mer-1a Context++ Score: -0.437 |
TargetScan alternative allele (gain)
miRNA 3' GACACAAAGUCGAGUCAUCCGU 5' hsa-miR-24-2-5p | Start: 37 End: 44Site type: 8mer-1a Context++ Score: -0.438 |
RNAhybrid reference allele (loss)
|
|
RNAhybrid alternative allele (loss)
|
|
Functions
Dysregulated fucntions of SNP-ceRNA event
Hallmarks
Dysregulated hallmarks of SNP-ceRNA event
Network
The AL035696.1-associated ceRNA network which were dysregulated by rs5873734
Related ceRNA network disturbed by SNP
Survival
Survival status of ceRNA interaction
Samples
Samples with different genotypes
Annotations
External Annotation for AL035696.1
LncRNA-associated competing triplets and functions.
Comprehensive experimentally supported associations between lncRNA and human cancer.
An open-source platform for studying the RNA-RNA interactions from CLIP-seq data.
An integrated knowledge database dedicated to non-coding RNAs.
An integrated database of human annotated lncRNA transcripts.
Comprehensive annotations of eukaryotic long non-coding RNAs.
External Annotation for hsa-miR-24-2-5p
A high quality database of published miRNA sequences and annotation.
A curated miRNA-target database developed by DIANA LAB.
A miRNA-target database by manually filter research articles related to functional studies of miRNAs.
A comprehensive of microRNA diversity, expression profiles, target relationships, and various supporting tools.
External Annotation for BCL2
Information on all annotated and predicted human genes.
Gene nomenclature, gene families and associated resources (genomic, proteomic, phenotypic information).
Genome browser for vertebrate genomes.
An annotated collection of all publicly available DNA sequences.
External Annotation for variation: rs5873734
A comprehensive, authoritative compendium of human genes and genetic phenotypes.
A database of human single nucleotide variations, microsatellites, and small-scale insertions and deletions
The catalogue of somatic mutations in cancer.